Part:BBa_K2991004
Opti-pBad optimized promoter BBa_I13453 (Arabinose)
Promoter pBad (BBa_l13453) to induce transcription in presence of arabinose. It includes the optimal CRP fixation site.
See more results on our wiki page.
CRP (cAMP Receptor Protein) is a transcription activator able to interact with the alpha subunit of the RNApolymerase. When this protein bind to the specific DNA sites in or near the promoter it can recruit the DNA polymerase.
This protein also known as CAP for Catabolite Activator Protein is a homodimer capable of binding cAMP. [1]
cAMP signaling is linked with the metabolic need and energetic state during growth [2].The interaction causes conformational changes of CRP with a strong affinity to specific sequences of DNA allowing it to interact with the RNApolymerase.
Analysis [3] suggest that differential activation by CRP-cAMP can quantitatively explain much of the sugar hierarchy described in this publication.
Following this idea they managed to mutate the CRP binding site in a promoter to bring it close to its consensus sequence (AAATGTGATCTAGATCACATT [4] ). By increasing the ability to bind CRP they moved the promoter position to a higher place in the hierarchy.
The optimisation of pARA
In our project we decided to extend this strategy to the Arabinose promoter sequences available on the registry. We chose to focus on the well known BBa_I13453 (registry star) and BBa_K206000 (mutated on the Aral1 operator sites by British-Columbia 2009). Here you can find already optimized version we try to made : BBa_K2991003,BBa_K2991004 and BBa_K2991005 We ordered these parts associated with a CFP reporter gene, as well as a second version of these parts with the consensus sequence of CRP (AAATGTGATCTAGATCACATT). .
After transforming top10 E.coli we obtained and tested :
- “1” : pIDT pARAI13453 - CFP ( BBa_K2991017 )
- “2” : pIDT pARAI13453 optimized - CFP ( BBa_K2991018)
We then cultivated our bacteria in M9 medium with 0.2% arabinose. Our 4 different bacterial cultures were followed by spectrofluorometry for 17 hours. The fluorescence observed in the graphs below has been normalized with the Optical Density (OD).
● Top10 E.coli 1 and 2
As a reminder, in this case the top10 E.coli was transformed with plasmids containing the pARA part I13453 either optimized with the consensus sequence of CRP (AAATGTGATCTAGATCACATT) (“2”), and non optimized (“1”).
Figure 19: CFP Fluorescence normalized with OD for E.coli T10 transformed with the part 1 and 2 in the absence of any sugar (◇), in the presence of 0.2% arabinose (△) , 0,1% arabinose (☐), 0,05 % arabinose (+), 0.02% arabinose (○) and M9 rich medium (x)
Both strains express CFP, but we observe no difference between the optimised pARA part CFP (2) and the non optimised part (1). We can conclude that the optimisation by the consensus sequence of CRP (AAATGTGATCTAGATCACATT) does not seem to have significant effect on the activity of the pARA I13453.
[1]E. Fic et al., “Fax +41 61 306 12 34 E-Mail karger@karger.ch cAMP Receptor Protein from Escherichia coli as a Model of Signal Transduction in Proteins-A Review,” J Mol Microbiol Biotechnol, vol. 17, pp. 1–11, 2009.
[2]C. You et al., “Coordination of bacterial proteome with metabolism by cyclic AMP signalling,” Nature, vol. 500, no. 7462, pp. 301–306, 2013.
[3]G. Aidelberg, B. D. Towbin, D. Rothschild, E. Dekel, A. Bren, and U. Alon, “Hierarchy of non-glucose sugars in Escherichia coli,” BMC Syst. Biol., vol. 8, p. 133, 2014.
[4]I. M. Keseler et al., “EcoCyc: Fusing model organism databases with systems biology,” Nucleic Acids Res., vol. 41, no. D1, Jan. 2013.
Usage and Biology
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 16
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 125
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 65
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 16
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 16
- 1000COMPATIBLE WITH RFC[1000]
| None |